ORK06129

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06129

Order Kazusa clone(s) from :

Accession No	AB209311
Product ID	ORK06129
Clone name	fh02524
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NEBL
cDNA sequence	DNA sequence (5625 bp) Predicted protein sequence (345 aa)
Description	Nebulette (Actin-binding Z-disk protein).

Features of the cloned cDNA sequence

Description

Length: 5625 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4586 bp
Genome contig ID	gi89161187r_21010096
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTGTTAACACCAGCTATTAAAATATATTTTAGTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGCTTTAATTCATATTTTTTTCCTCTACACTGTGAATCTTTAAGCCT

Features of the protein sequence

Description

Length: 345 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92548	2.1e-102	100.0	nebulette non-m...	Homo sapiens
CAE45323	6e-77	99.6	LIM-nebulette [...	Homo sapiens
XP_859080	1.4e-76	98.8	similar to nebu...	Canis lupus fam...
EDL78760	1.4e-75	97.7	rCG55853, isofo...	Rattus norvegicus
BAB23436	1.2e-74	97.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	78	132	PD000094	Zinc finger
BlastProDom	IPR001452	289	342	PD000066	Src homology-3
FPrintScan	IPR001452	288	298	PR00452	Src homology-3
	IPR001452	302	317	PR00452	Src homology-3
	IPR001452	332	344	PR00452	Src homology-3
HMMPfam	IPR001781	80	137	PF00412	Zinc finger
	IPR000900	142	170	PF00880	Nebulin 35 residue motif
	IPR000900	178	206	PF00880	Nebulin 35 residue motif
	IPR001452	288	344	PF00018	Src homology-3
HMMSmart	IPR001781	79	131	SM00132	Zinc finger
	IPR000900	137	167	SM00227	Nebulin 35 residue motif
	IPR000900	173	203	SM00227	Nebulin 35 residue motif
	IPR000900	209	239	SM00227	Nebulin 35 residue motif
	IPR001452	288	345	SM00326	Src homology-3
ProfileScan	IPR001781	78	138	PS50023	Zinc finger
	IPR000900	136	170	PS51216	Nebulin 35 residue motif
	IPR000900	172	206	PS51216	Nebulin 35 residue motif
	IPR000900	208	234	PS51216	Nebulin 35 residue motif
	IPR001452	285	345	PS50002	Src homology-3
ScanRegExp	IPR001781	80	114	PS00478	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp