ORK06406

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06406

Order Kazusa clone(s) from :

Accession No	AB208934
Product ID	ORK06406
Clone name	ah04823
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PLXNC1
cDNA sequence	DNA sequence (6020 bp) Predicted protein sequence (1211 aa)
Description	Plexin-C1 precursor (Virus-encoded semaphorin protein receptor) (CD232 antigen).

Features of the cloned cDNA sequence

Description

Length: 6020 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2383 bp
Genome contig ID	gi89161190f_92987068
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AAATGTCTATATCCAAAAAATAAACATTTTGATGT
Flanking genome sequence (238509 - 238558)	----+--------+--------+--------+--------+----* AACTGTGGACTGTCTTTTTTTTTTTTCAATTTTCTAGTTATAATAGTTTT

Features of the protein sequence

Description

Length: 1211 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92171	100.0	plexin C1 varia...	Homo sapiens
O60486	99.9	Plexin-C1; Viru...	Homo sapiens
XP_509270	99.7	plexin C1 [Pan ...	Pan troglodytes
XP_001105619	98.9	similar to plex...	Macaca mulatta
Q9QZC2	90.6	Plexin-C1; Viru...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002165	97	150	PF01437	Plexin
	IPR002165	234	278	PF01437	Plexin
	IPR002909	307	393	PF01833	Cell surface receptor IPT/TIG
	IPR002909	397	483	PF01833	Cell surface receptor IPT/TIG
	IPR013548	654	1178	PF08337	Plexin cytoplasmic region
HMMSmart	IPR003659	97	150	SM00423	Plexin/semaphorin/integrin
	IPR003659	234	278	SM00423	Plexin/semaphorin/integrin
	IPR002909	396	484	SM00429	Cell surface receptor IPT/TIG
	IPR002909	486	591	SM00429	Cell surface receptor IPT/TIG
ProfileScan	IPR001627	1	95	PS51004	Semaphorin/CD100 antigen
ScanRegExp	IPR000215	702	712	PS00284	Protease inhibitor I4

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	586	STWYFLIVLPVLLVIVIFAAVG	607	PRIMARY	22