Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06529
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208904
Product ID ORK06529
Clone name pf00494
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PTPN13
cDNA sequence DNA sequence (7911 bp)
Predicted protein sequence (2434 aa)
Description Tyrosine-protein phosphatase non-receptor type 13 (EC 3.1.3.48) (Protein-tyrosine phosphatase 1E) (PTP-E1) (hPTPE1) (PTP-BAS) (Protein-tyrosine phosphatase PTPL1) (Fas-associated protein-tyrosine phosphatase 1) (FAP-1).
Features of the cloned cDNA sequence

Length: 7911 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 606 bp
Genome contig ID gi89161207f_87712540
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
GTAAATAAAAACACACCTTAAAACATGAACACGCC
Flanking genome sequence
(242796 - 242845)
----+----*----+----*----+----*----+----*----+----*
AAAACTGTGTGCAGACAAATTAGACATTTTCAGTGTGTTATTTTTCAACA

Features of the protein sequence

Length: 2434 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92141 0 100.0 protein tyrosin...
Homo sapiens
EAX05966 0 99.8 protein tyrosin...
Homo sapiens
BAA04751 0 99.8 protein tyrosin...
Homo sapiens
CAA56563 0 99.6 protein-tyrosin...
Homo sapiens
XP_535644 0 89.5 similar to prot...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000299 573 585 PR00935 Band 4.1
IPR000299 649 662 PR00935 Band 4.1
IPR000299 662 682 PR00935 Band 4.1
IPR000299 729 745 PR00935 Band 4.1
IPR000242 2210 2217 PR00700 Protein-tyrosine phosphatase
IPR000242 2228 2248 PR00700 Protein-tyrosine phosphatase
IPR000242 2315 2332 PR00700 Protein-tyrosine phosphatase
IPR000242 2352 2370 PR00700 Protein-tyrosine phosphatase
IPR000242 2383 2398 PR00700 Protein-tyrosine phosphatase
IPR000242 2399 2409 PR00700 Protein-tyrosine phosphatase
HMMPfam IPR000299 542 749 PF00373 Band 4.1
IPR001478 1042 1125 PF00595 PDZ/DHR/GLGF
IPR001478 1317 1399 PF00595 PDZ/DHR/GLGF
IPR001478 1450 1535 PF00595 PDZ/DHR/GLGF
IPR001478 1737 1815 PF00595 PDZ/DHR/GLGF
IPR001478 1832 1912 PF00595 PDZ/DHR/GLGF
IPR000242 2186 2415 PF00102 Protein-tyrosine phosphatase
HMMSmart IPR011019 1 158 SM00750 KIND
IPR000299 536 749 SM00295 Band 4.1
IPR001478 1051 1128 SM00228 PDZ/DHR/GLGF
IPR001478 1325 1402 SM00228 PDZ/DHR/GLGF
IPR001478 1458 1538 SM00228 PDZ/DHR/GLGF
IPR001478 1746 1818 SM00228 PDZ/DHR/GLGF
IPR001478 1840 1915 SM00228 PDZ/DHR/GLGF
IPR000242 2161 2418 SM00194 Protein-tyrosine phosphatase
IPR003595 2316 2415 SM00404 Protein-tyrosine phosphatase
ProfileScan IPR000299 540 840 PS50057 Band 4.1
IPR001478 1042 1128 PS50106 PDZ/DHR/GLGF
IPR001478 1317 1402 PS50106 PDZ/DHR/GLGF
IPR001478 1450 1538 PS50106 PDZ/DHR/GLGF
IPR001478 1737 1818 PS50106 PDZ/DHR/GLGF
IPR001478 1832 1915 PS50106 PDZ/DHR/GLGF
IPR000242 2162 2416 PS50055 Protein-tyrosine phosphatase
IPR000387 2338 2407 PS50056 Protein-tyrosine phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp