Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06573
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209424
Product ID ORK06573
Clone name pg00883
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol IFT27
cDNA sequence DNA sequence (6478 bp)
Predicted protein sequence (294 aa)
Description Putative GTP-binding protein RAY-like (Rab-like protein 4).
Features of the cloned cDNA sequence

Length: 6478 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5592 bp
Genome contig ID gi89161203r_35384201
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AATGATGGCTTTAAATAAAATTAGGAGAAAATGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAAGCAGCAGCTCCTTCCACTCTTGGCCTGGGTGGCCCTAGTTCCACTGT

Features of the protein sequence

Length: 294 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92661 5.3e-93 100.0 Putative GTP-bi...
Homo sapiens
EAW60114 2.3e-77 99.6 RAB, member of ...
Homo sapiens
Q9BW83 6e-31 100.0 Putative GTP-bi...
Homo sapiens
AAP36177 6e-31 100.0 RAB, member of ...
synthetic construct
CAA18787 5.9e-30 99.1 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001806 145 166 PR00449 Ras GTPase
IPR001806 170 186 PR00449 Ras GTPase
IPR001806 190 212 PR00449 Ras GTPase
HMMPfam IPR013684 146 261 PF08477 Miro-like
HMMSmart IPR003579 145 279 SM00175 Ras small GTPase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 125 AALVLWVRLAGVLVTMVKLAAKC 147 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp