ORK06573

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06573

Order Kazusa clone(s) from :

Accession No	AB209424
Product ID	ORK06573
Clone name	pg00883
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IFT27
cDNA sequence	DNA sequence (6478 bp) Predicted protein sequence (294 aa)
Description	Putative GTP-binding protein RAY-like (Rab-like protein 4).

Features of the cloned cDNA sequence

Description

Length: 6478 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5592 bp
Genome contig ID	gi89161203r_35384201
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AATGATGGCTTTAAATAAAATTAGGAGAAAATGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAAGCAGCAGCTCCTTCCACTCTTGGCCTGGGTGGCCCTAGTTCCACTGT

Features of the protein sequence

Description

Length: 294 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92661	5.3e-93	100.0	Putative GTP-bi...	Homo sapiens
EAW60114	2.3e-77	99.6	RAB, member of ...	Homo sapiens
Q9BW83	6e-31	100.0	Putative GTP-bi...	Homo sapiens
AAP36177	6e-31	100.0	RAB, member of ...	synthetic construct
CAA18787	5.9e-30	99.1	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	145	166	PR00449	Ras GTPase
	IPR001806	170	186	PR00449	Ras GTPase
	IPR001806	190	212	PR00449	Ras GTPase
HMMPfam	IPR013684	146	261	PF08477	Miro-like
HMMSmart	IPR003579	145	279	SM00175	Ras small GTPase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	125	AALVLWVRLAGVLVTMVKLAAKC	147	PRIMARY	23