Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06575
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209410
Product ID ORK06575
Clone name fh24539
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RAC1
cDNA sequence DNA sequence (5408 bp)
Predicted protein sequence (144 aa)
Description Ras-related C3 botulinum toxin substrate 1 precursor (p21-Rac1) (Ras- like protein TC25) (Cell migration-inducing gene 5 protein).
Features of the cloned cDNA sequence

Length: 5408 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4971 bp
Genome contig ID gi89161213f_6280704
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCCTGGGCGACAGAGCGAGACTCCCTCTCAAAAAC
Flanking genome sequence
(122490 - 122539)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGAAAAGAAACCCCGTCTCTACTAAAAATACAA

Features of the protein sequence

Length: 144 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92647 3.9e-48 100.0 ras-related C3 ...
Homo sapiens
EDL19047 4.7e-27 78.3 RAS-related C3 ...
Mus musculus
XP_001379520 2e-23 89.2 similar to GTPa...
Monodelphis dom...
CAF93882 5.6e-22 96.1 unnamed protein...
Tetraodon nigro...
2H7V 8e-22 100.0 Migration-induc...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001806 66 87 PR00449 Ras GTPase
IPR001806 89 105 PR00449 Ras GTPase
IPR001806 106 128 PR00449 Ras GTPase
HMMPfam IPR013753 67 137 PF00071 Ras
HMMSmart IPR003578 68 143 SM00174 Ras small GTPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp