ORK06608

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06608

Order Kazusa clone(s) from :

Accession No	AB208813
Product ID	ORK06608
Clone name	fh19454
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RBM5
cDNA sequence	DNA sequence (5610 bp) Predicted protein sequence (505 aa)
Description	RNA-binding protein 5 (RNA-binding motif protein 5) (Tumor suppressor LUCA15) (Protein G15) (Renal carcinoma antigen NY-REN-9).

Features of the cloned cDNA sequence

Description

Length: 5610 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	501 bp
Genome contig ID	gi89161205f_50001400
PolyA signal sequence (AAGAAA,-15)	+--------+--------+----*----+---- CAAATCTGGCTCCTTTACAAAAGAAATACCTTGAG
Flanking genome sequence (129996 - 130045)	----+--------+--------+--------+--------+----* AAATGGGTGTCCTGTGTCTCTTTATTCTTGGGTGGGTAGGTGGGTCAAGC

Features of the protein sequence

Description

Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92050	4.9e-164	100.0	RNA binding mot...	Homo sapiens
P52756	1.5e-161	99.2	RNA-binding pro...	Homo sapiens
XP_001167117	2.1e-161	99.0	RNA binding mot...	Pan troglodytes
XP_001103773	2.1e-161	99.0	RNA binding mot...	Macaca mulatta
XP_001496627	6.2e-161	98.6	similar to RNA ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000467	433	477	PF01585	D111/G-patch
HMMSmart	IPR000467	431	477	SM00443	D111/G-patch
ProfileScan	IPR007087	337	367	PS50157	Zinc finger
ProfileScan	IPR000467	433	479	PS50174	D111/G-patch

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp