ORK06645

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06645

Order Kazusa clone(s) from :

Accession No	AB209019
Product ID	ORK06645
Clone name	hj02913
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RGS4
cDNA sequence	DNA sequence (5233 bp) Predicted protein sequence (135 aa)
Description	Regulator of G-protein signaling 4 (RGS4) (RGP4).

Features of the cloned cDNA sequence

Description

Length: 5233 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2028 bp
Genome contig ID	gi89161185f_161207780
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- ACTCTGAATGAGAAGTAAATTATTTTATGTAATAC
Flanking genome sequence (105229 - 105278)	----+--------+--------+--------+--------+----* ATTTTTGAGTGTGTTTTTCAGTTGTATTTCCCTGTTATTTCATCACTATT

Features of the protein sequence

Description

Length: 135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92256	2.4e-60	100.0	regulator of G-...	Homo sapiens
BAG62483	6.8e-32	74.7	unnamed protein...	Homo sapiens
CAH90892	8e-32	83.8	hypothetical pr...	Pongo abelii
Q5R747	8e-32	83.8	Regulator of G-...	Pongo abelii
CAH73768	8.9e-32	83.8	regulator of G-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000342	56	108	PD001580	Regulator of G protein signalling
FPrintScan	IPR000342	40	63	PR01301	Regulator of G protein signalling
FPrintScan	IPR000342	82	101	PR01301	Regulator of G protein signalling
HMMPfam	IPR000342	55	108	PF00615	Regulator of G protein signalling
HMMSmart	IPR000342	4	108	SM00315	Regulator of G protein signalling
ProfileScan	IPR000342	45	108	PS50132	Regulator of G protein signalling

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp