Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06645
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209019
Product ID ORK06645
Clone name hj02913
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RGS4
cDNA sequence DNA sequence (5233 bp)
Predicted protein sequence (135 aa)
Description Regulator of G-protein signaling 4 (RGS4) (RGP4).
Features of the cloned cDNA sequence

Length: 5233 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2028 bp
Genome contig ID gi89161185f_161207780
PolyA signal sequence
(AGTAAA,-22)
+----*----+----*----+----*----+----
ACTCTGAATGAGAAGTAAATTATTTTATGTAATAC
Flanking genome sequence
(105229 - 105278)
----+----*----+----*----+----*----+----*----+----*
ATTTTTGAGTGTGTTTTTCAGTTGTATTTCCCTGTTATTTCATCACTATT

Features of the protein sequence

Length: 135 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92256 2.4e-60 100.0 regulator of G-...
Homo sapiens
BAG62483 6.8e-32 74.7 unnamed protein...
Homo sapiens
CAH90892 8e-32 83.8 hypothetical pr...
Pongo abelii
Q5R747 8e-32 83.8 Regulator of G-...
Pongo abelii
CAH73768 8.9e-32 83.8 regulator of G-...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000342 56 108 PD001580 Regulator of G protein signalling
FPrintScan IPR000342 40 63 PR01301 Regulator of G protein signalling
IPR000342 82 101 PR01301 Regulator of G protein signalling
HMMPfam IPR000342 55 108 PF00615 Regulator of G protein signalling
HMMSmart IPR000342 4 108 SM00315 Regulator of G protein signalling
ProfileScan IPR000342 45 108 PS50132 Regulator of G protein signalling
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp