ORK06656

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06656

Order Kazusa clone(s) from :

Accession No	AB209445
Product ID	ORK06656
Clone name	pj02565
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RIN1
cDNA sequence	DNA sequence (4415 bp) Predicted protein sequence (651 aa)
Description	Ras and Rab interactor 1 (Ras interaction/interference protein 1) (Ras inhibitor JC99).

Features of the cloned cDNA sequence

Description

Length: 4415 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2033 bp
Genome contig ID	gi51511727r_65754369
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAATGCCATAGGCGTTCAATAAATGTTGTTCACTG
Flanking genome sequence (99920 - 99871)	----+--------+--------+--------+--------+----* ATTGGAGTTTGATAACCAGGAGTGAGGGACAGTGAGGCAGAAACCTGGGG

Features of the protein sequence

Description

Length: 651 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92682	3.2e-214	100.0	ras inhibitor R...	Homo sapiens
Q13671	4.5e-196	99.8	Ras and Rab int...	Homo sapiens
AAB67270	1.6e-193	98.5	ras interactor ...	Homo sapiens
XP_001110464	3.3e-188	96.0	similar to ras ...	Macaca mulatta
XP_001916910	4.9e-163	84.7	Ras and Rab int...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003123	360	462	PF02204	Vacuolar sorting protein 9
HMMPfam	IPR000159	492	573	PF00788	Ras-association
HMMSmart	IPR013995	357	475	SM00167	Vacuolar sorting protein 9
HMMSmart	IPR000159	492	573	SM00314	Ras-association
ProfileScan	IPR003123	324	466	PS51205	Vacuolar sorting protein 9
ProfileScan	IPR000159	492	574	PS50200	Ras-association

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp