Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06758
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226075
Product ID ORK06758
Clone name sj03402
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SEH1L
cDNA sequence DNA sequence (4077 bp)
Predicted protein sequence (155 aa)
Description Nucleoporin SEH1-like (SEC13-like protein).
Features of the cloned cDNA sequence

Length: 4077 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 466 bp
Genome contig ID gi51511735f_12861653
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTAATTTGAAGATTGAATAAATATTTTTTATAAAG
Flanking genome sequence
(114066 - 114115)
----+----*----+----*----+----*----+----*----+----*
ATTGTTTTGAGTGCTGATTTGTTTACTTTTTGTAGATTTGCTTTATCCAT

Features of the protein sequence

Length: 155 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAG49437 1.1e-63 100.0 sec13-like prot...
Homo sapiens
CAH91174 2.8e-63 99.3 hypothetical pr...
Pongo abelii
AAM21169 3.3e-63 99.3 putative nucleo...
Homo sapiens
AAI51607 8.8e-63 98.0 SEH1L protein [...
Bos taurus
BAB71317 3.6e-62 100.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 69 100 PD000018 WD40 repeat
HMMPfam IPR001680 63 101 PF00400 WD40 repeat
HMMSmart IPR001680 62 101 SM00320 WD40 repeat
ProfileScan IPR001680 69 101 PS50082 WD40 repeat
IPR001680 69 110 PS50294 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp