ORK06760

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06760

Order Kazusa clone(s) from :

Accession No	AB209259
Product ID	ORK06760
Clone name	fk00237
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEMA3F
cDNA sequence	DNA sequence (3214 bp) Predicted protein sequence (750 aa)
Description	Semaphorin-3F precursor (Semaphorin IV) (Sema IV) (Sema III/F).

Features of the cloned cDNA sequence

Description

Length: 3214 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	961 bp
Genome contig ID	gi89161205f_50067528
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TCCATCTTGCTAATAAACACTGGCTCTGGGACTAG
Flanking genome sequence (133985 - 134034)	----+--------+--------+--------+--------+----* ACTTTGGCTTCTCTCCTTGGTCAGGGGATTTAGAGCCACACGTGGTGGGC

Features of the protein sequence

Description

Length: 750 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92496	100.0	semaphorin 3F v...	Homo sapiens
EAW65043	99.7	sema domain, im...	Homo sapiens
AAB18276	99.5	semaphorin III ...	Homo sapiens
XP_001103514	98.7	similar to sema...	Macaca mulatta
XP_001103347	97.4	similar to sema...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	53	494	PF01403	Semaphorin/CD100 antigen
HMMPfam	IPR013151	584	645	PF00047	Immunoglobulin
HMMSmart	IPR001627	53	494	SM00630	Semaphorin/CD100 antigen
	IPR003659	512	564	SM00423	Plexin/semaphorin/integrin
	IPR003599	576	662	SM00409	Immunoglobulin subtype
	IPR003598	582	650	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR001627	27	510	PS51004	Semaphorin/CD100 antigen
ProfileScan	IPR007110	584	655	PS50835	Immunoglobulin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp