Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06801
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209856
Product ID ORK06801
Clone name ef01757
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SRSF4
cDNA sequence DNA sequence (8245 bp)
Predicted protein sequence (419 aa)
Description Splicing factor, arginine/serine-rich 4 (Pre-mRNA-splicing factor SRP75) (SRP001LB).
Features of the cloned cDNA sequence

Length: 8245 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 557 bp
Genome contig ID gi89161185r_29246952
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CATATTCTGGTATTGTGATTATATTGTTTTATATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAGAAAAGAATTTTTTTTAATTTTATTTTTCCCCGTCTTGC

Features of the protein sequence

Length: 419 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93093 1.5e-109 100.0 splicing factor...
Homo sapiens
EAX07657 6.1e-107 99.5 splicing factor...
Homo sapiens
EAX07658 6.2e-107 99.5 splicing factor...
Homo sapiens
XP_001154822 1.7e-106 99.0 similar to Sfrs...
Pan troglodytes
XP_001155042 1.7e-106 99.0 splicing factor...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 31 97 PF00076 RNA recognition motif
HMMSmart IPR000504 30 98 SM00360 RNA recognition motif
ProfileScan IPR000504 29 102 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp