Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06927
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209013
Product ID ORK06927
Clone name hg03450
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SNX1
cDNA sequence DNA sequence (6224 bp)
Predicted protein sequence (432 aa)
Description Sorting nexin-1.
Features of the cloned cDNA sequence

Length: 6224 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4718 bp
Genome contig ID gi51511731f_62075243
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTAGGTGGCAGAGCGAGATCTTGTCTC
Flanking genome sequence
(146338 - 146387)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGCAGCTCTGGATGGGAAGGGAGGCCAGTTGCTTTAAGTAG

Features of the protein sequence

Length: 432 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92250 2.7e-160 100.0 sorting nexin 1...
Homo sapiens
XP_001174054 1.3e-156 100.0 sorting nexin 1...
Pan troglodytes
CAH89408 7.2e-149 94.4 hypothetical pr...
Pongo abelii
XP_001174058 8.3e-149 99.5 sorting nexin 1...
Pan troglodytes
Q13596 8.3e-149 99.5 Sorting nexin-1.
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001683 51 178 PF00787 Phox-like
IPR015404 194 427 PF09325 Vps5 C terminal like
HMMSmart IPR001683 51 178 SM00312 Phox-like
ProfileScan IPR001683 53 182 PS50195 Phox-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp