ORK07005

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07005

Order Kazusa clone(s) from :

Accession No	AB209772
Product ID	ORK07005
Clone name	bm01529
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	STARD3
cDNA sequence	DNA sequence (2442 bp) Predicted protein sequence (210 aa)
Description	StAR-related lipid transfer protein 3 (StARD3) (START domain- containing protein 3) (Metastatic lymph node protein 64) (Protein MLN 64) (Protein CAB1).

Features of the cloned cDNA sequence

Description

Length: 2442 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	561 bp
Genome contig ID	gi51511734f_34968225
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- GACCTTTGTATTAAGCCAATTAAAAACATGAATTT
Flanking genome sequence (105025 - 105074)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATTCCAGCCCCTCCCACTGCCTTGCCTCTTGAGGGA

Features of the protein sequence

Description

Length: 210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93009	4.4e-91	100.0	steroidogenic a...	Homo sapiens
XP_001172243	1.5e-65	99.3	steroidogenic a...	Pan troglodytes
XP_001172209	1.5e-65	99.3	steroidogenic a...	Pan troglodytes
CAA56489	1.6e-65	99.3	MLN 64 [Homo sa...	Homo sapiens
Q14849	1.6e-65	99.3	StAR-related li...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000799	61	80	PR00978	Steroidogenic acute regulatory protein
	IPR000799	80	97	PR00978	Steroidogenic acute regulatory protein
	IPR000799	97	117	PR00978	Steroidogenic acute regulatory protein
	IPR000799	119	137	PR00978	Steroidogenic acute regulatory protein
	IPR000799	150	169	PR00978	Steroidogenic acute regulatory protein
	IPR000799	169	188	PR00978	Steroidogenic acute regulatory protein
	IPR000799	189	210	PR00978	Steroidogenic acute regulatory protein
HMMPfam	IPR002913	5	209	PF01852	Lipid-binding START
HMMSmart	IPR002913	5	209	SM00234	Lipid-binding START
ProfileScan	IPR002913	64	208	PS50848	Lipid-binding START

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp