ORK07196

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07196

Order Kazusa clone(s) from :

Accession No	AK226119
Product ID	ORK07196
Clone name	hh03691
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRIM11
cDNA sequence	DNA sequence (5774 bp) Predicted protein sequence (360 aa)
Description	Tripartite motif-containing protein 11 (EC 6.3.2.-) (RING finger protein 92) (Protein BIA1).

Features of the cloned cDNA sequence

Description

Length: 5774 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1032 bp
Genome contig ID	gi89161185r_226547997
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- CACGTTAAATAAACTTTGGCTGTTGTCTACAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCCTGCTGGTGCCTGCTTAGTCCAGGAACAATAGCGGGTGCCCCACTGC

Features of the protein sequence

Description

Length: 360 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96F44	1.1e-127	99.7	E3 ubiquitin-pr...	Homo sapiens
BAG37129	2.5e-127	99.3	unnamed protein...	Homo sapiens
BAG53535	2.7e-126	98.7	unnamed protein...	Homo sapiens
XP_001082465	3.1e-126	98.7	similar to trip...	Macaca mulatta
BAG63300	8.6e-122	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003879	177	194	PR01407	Butyrophylin-like
	IPR003879	194	211	PR01407	Butyrophylin-like
	IPR003879	216	240	PR01407	Butyrophylin-like
	IPR003879	246	259	PR01407	Butyrophylin-like
	IPR003879	287	311	PR01407	Butyrophylin-like
	IPR003879	318	336	PR01407	Butyrophylin-like
HMMPfam	IPR003877	231	350	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR006574	178	230	SM00589	SPRY-associated
HMMSmart	IPR003877	231	350	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR001870	160	353	PS50188	B302

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp