Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07196
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226119
Product ID ORK07196
Clone name hh03691
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TRIM11
cDNA sequence DNA sequence (5774 bp)
Predicted protein sequence (360 aa)
Description Tripartite motif-containing protein 11 (EC 6.3.2.-) (RING finger protein 92) (Protein BIA1).
Features of the cloned cDNA sequence

Length: 5774 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1032 bp
Genome contig ID gi89161185r_226547997
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
CACGTTAAATAAACTTTGGCTGTTGTCTACAAGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCCTGCTGGTGCCTGCTTAGTCCAGGAACAATAGCGGGTGCCCCACTGC

Features of the protein sequence

Length: 360 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96F44 1.1e-127 99.7 E3 ubiquitin-pr...
Homo sapiens
BAG37129 2.5e-127 99.3 unnamed protein...
Homo sapiens
BAG53535 2.7e-126 98.7 unnamed protein...
Homo sapiens
XP_001082465 3.1e-126 98.7 similar to trip...
Macaca mulatta
BAG63300 8.6e-122 99.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003879 177 194 PR01407 Butyrophylin-like
IPR003879 194 211 PR01407 Butyrophylin-like
IPR003879 216 240 PR01407 Butyrophylin-like
IPR003879 246 259 PR01407 Butyrophylin-like
IPR003879 287 311 PR01407 Butyrophylin-like
IPR003879 318 336 PR01407 Butyrophylin-like
HMMPfam IPR003877 231 350 PF00622 SPla/RYanodine receptor SPRY
HMMSmart IPR006574 178 230 SM00589 SPRY-associated
IPR003877 231 350 SM00449 SPla/RYanodine receptor SPRY
ProfileScan IPR001870 160 353 PS50188 B302
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp