ORK07204

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07204

Order Kazusa clone(s) from :

Accession No	AB209284
Product ID	ORK07204
Clone name	fk04920
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRIM39
cDNA sequence	DNA sequence (3187 bp) Predicted protein sequence (352 aa)
Description	Tripartite motif-containing protein 39 (RING finger protein 23) (Testis-abundant finger protein).

Features of the cloned cDNA sequence

Description

Length: 3187 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2127 bp
Genome contig ID	gi89161210f_30305250
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAAAATAATATGGAACAAAGGATCCACTGAAGTG
Flanking genome sequence (114236 - 114285)	----+--------+--------+--------+--------+----* ATCTCTGTGTTGTGTGGTAATTTGGTGACAGCCTTGTACTGATGTGTAAG

Features of the protein sequence

Description

Length: 352 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92521	1e-126	100.0	tripartite moti...	Homo sapiens
AAH07661	2.5e-116	100.0	TRIM39 protein ...	Homo sapiens
AAP36295	2.5e-116	100.0	tripartite moti...	synthetic construct
BAD83393	4.2e-116	99.6	tripartite moti...	Sus scrofa
XP_001492226	7.1e-116	99.3	similar to trip...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	56	73	PR01406	Zinc finger
	IPR000315	75	89	PR01406	Zinc finger
	IPR003879	246	263	PR01407	Butyrophylin-like
	IPR003879	263	280	PR01407	Butyrophylin-like
	IPR003879	286	310	PR01407	Butyrophylin-like
	IPR003879	316	329	PR01407	Butyrophylin-like
HMMPfam	IPR000315	43	84	PF00643	Zinc finger
HMMPfam	IPR003877	301	331	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR000315	43	84	SM00336	Zinc finger
HMMSmart	IPR006574	247	300	SM00589	SPRY-associated
ProfileScan	IPR000315	43	84	PS50119	Zinc finger
ProfileScan	IPR001870	230	352	PS50188	B302

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp