ORK07206

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07206

Order Kazusa clone(s) from :

Accession No	AB209243
Product ID	ORK07206
Clone name	fj16937
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRIM52
cDNA sequence	DNA sequence (4749 bp) Predicted protein sequence (311 aa)
Description	Tripartite motif-containing protein 52 (RING finger protein 102).

Features of the cloned cDNA sequence

Description

Length: 4749 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3565 bp
Genome contig ID	gi51511721r_180516109
PolyA signal sequence (AATAGA,-21)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAATAGAGCAAGACTCCATCTC
Flanking genome sequence (99885 - 99836)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATCGGCTCATCTTTTATTGCTGTTGGTTGAGATGAA

Features of the protein sequence

Description

Length: 311 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92480	4.3e-125	100.0	tripartite moti...	Homo sapiens
EAW53705	6.7e-108	99.2	tripartite moti...	Homo sapiens
EAW53703	1.3e-107	99.6	tripartite moti...	Homo sapiens
Q96A61	1.3e-107	99.6	Tripartite moti...	Homo sapiens
XP_001158522	2.6e-100	93.7	similar to trip...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	260	277	PR01406	Zinc finger
FPrintScan	IPR000315	279	293	PR01406	Zinc finger
HMMPfam	IPR001841	46	82	PF00097	Zinc finger
HMMPfam	IPR000315	247	288	PF00643	Zinc finger
HMMSmart	IPR001841	46	211	SM00184	Zinc finger
HMMSmart	IPR000315	247	288	SM00336	Zinc finger
ProfileScan	IPR001841	46	72	PS50089	Zinc finger
ProfileScan	IPR000315	247	288	PS50119	Zinc finger
ScanRegExp	IPR001841	61	70	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp