ORK07513

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07513

Order Kazusa clone(s) from :

Accession No	AB208784
Product ID	ORK07513
Clone name	fj18232
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF76
cDNA sequence	DNA sequence (4652 bp) Predicted protein sequence (222 aa)
Description	Zinc finger protein 76.

Features of the cloned cDNA sequence

Description

Length: 4652 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2350 bp
Genome contig ID	gi89161210f_35234912
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGATGAATGAGTATTTAATAAAAGTTCCAAATTTC
Flanking genome sequence (136828 - 136877)	----+--------+--------+--------+--------+----* CACCTGGGTCCCTCCATCCTTTCAGCTCTAGGCCCGGGTGGCAGGGTTGG

Features of the protein sequence

Description

Length: 222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92021	1.8e-81	100.0	zinc finger pro...	Homo sapiens
EAX03814	5e-33	69.5	zinc finger pro...	Homo sapiens
BAG58260	5.1e-33	67.4	unnamed protein...	Homo sapiens
BAG57792	6e-33	92.1	unnamed protein...	Homo sapiens
EAX03816	6.7e-33	92.1	zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	39	64	PD000003	Zinc finger
BlastProDom	IPR007087	69	94	PD000003	Zinc finger
HMMPfam	IPR007087	39	63	PF00096	Zinc finger
	IPR007087	69	93	PF00096	Zinc finger
	IPR007087	99	123	PF00096	Zinc finger
HMMSmart	IPR015880	39	63	SM00355	Zinc finger
	IPR015880	69	93	SM00355	Zinc finger
	IPR015880	99	123	SM00355	Zinc finger
ProfileScan	IPR007087	39	68	PS50157	Zinc finger
	IPR007087	69	98	PS50157	Zinc finger
	IPR007087	99	128	PS50157	Zinc finger
ScanRegExp	IPR007087	41	63	PS00028	Zinc finger
	IPR007087	71	93	PS00028	Zinc finger
	IPR007087	101	123	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp