Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07513
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208784
Product ID ORK07513
Clone name fj18232
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF76
cDNA sequence DNA sequence (4652 bp)
Predicted protein sequence (222 aa)
Description Zinc finger protein 76.
Features of the cloned cDNA sequence

Length: 4652 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2350 bp
Genome contig ID gi89161210f_35234912
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGATGAATGAGTATTTAATAAAAGTTCCAAATTTC
Flanking genome sequence
(136828 - 136877)
----+----*----+----*----+----*----+----*----+----*
CACCTGGGTCCCTCCATCCTTTCAGCTCTAGGCCCGGGTGGCAGGGTTGG

Features of the protein sequence

Length: 222 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92021 1.8e-81 100.0 zinc finger pro...
Homo sapiens
EAX03814 5e-33 69.5 zinc finger pro...
Homo sapiens
BAG58260 5.1e-33 67.4 unnamed protein...
Homo sapiens
BAG57792 6e-33 92.1 unnamed protein...
Homo sapiens
EAX03816 6.7e-33 92.1 zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 39 64 PD000003 Zinc finger
IPR007087 69 94 PD000003 Zinc finger
HMMPfam IPR007087 39 63 PF00096 Zinc finger
IPR007087 69 93 PF00096 Zinc finger
IPR007087 99 123 PF00096 Zinc finger
HMMSmart IPR015880 39 63 SM00355 Zinc finger
IPR015880 69 93 SM00355 Zinc finger
IPR015880 99 123 SM00355 Zinc finger
ProfileScan IPR007087 39 68 PS50157 Zinc finger
IPR007087 69 98 PS50157 Zinc finger
IPR007087 99 128 PS50157 Zinc finger
ScanRegExp IPR007087 41 63 PS00028 Zinc finger
IPR007087 71 93 PS00028 Zinc finger
IPR007087 101 123 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp