Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07537
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209174
Product ID ORK07537
Clone name ah01423
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ACTR3B
cDNA sequence DNA sequence (5536 bp)
Predicted protein sequence (282 aa)
Description actin-related protein 3-beta isoform 2
Features of the cloned cDNA sequence

Length: 5536 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 818 bp
Genome contig ID gi89161213f_152038940
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TGCACCATTGTAATAAAAGCTGTTAGAATATTTGT
Flanking genome sequence
(144451 - 144500)
----+----*----+----*----+----*----+----*----+----*
AAATATCTTTCTGCTGTAGTGTGGTGGTCTGTTGGTTTTCTCCCTGTCGC

Features of the protein sequence

Length: 282 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92411 6.3e-124 100.0 actin-related p...
Homo sapiens
AAC98904 1.4e-119 99.6 actin-related p...
Homo sapiens
XP_001513007 3.5e-119 98.9 similar to acti...
Ornithorhynchus...
XP_532772 5.1e-119 98.5 similar to acti...
Canis lupus fam...
XP_001495828 8.4e-119 98.1 ARP3 actin-rela...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004000 10 273 PF00022 Actin/actin-like
HMMSmart IPR004000 1 277 SM00268 Actin/actin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp