Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07548
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209759
Product ID ORK07548
Clone name bh00352
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol YWHAB
cDNA sequence DNA sequence (5867 bp)
Predicted protein sequence (189 aa)
Description Homo sapiens mRNA for tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide variant protein.
Features of the cloned cDNA sequence

Length: 5867 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3391 bp
Genome contig ID gi51511747f_42847859
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CACTCTGTACCCTCAACATATATCCCTTGTGCGAT
Flanking genome sequence
(120702 - 120751)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAGAGAATCGTACGTCGACTTTCGATTTT

Features of the protein sequence

Length: 189 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92996 2e-76 100.0 tyrosine 3-mono...
Homo sapiens
CAI95661 7.2e-34 100.0 tyrosine 3-mono...
Homo sapiens
CAM20760 1e-33 100.0 tyrosine 3-mono...
Mus musculus
EDL06357 1.2e-33 99.0 tyrosine 3-mono...
Mus musculus
XP_001109676 1.2e-33 99.0 tyrosine 3-mono...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000308 52 142 PD000600 14-3-3 protein
FPrintScan IPR000308 79 108 PR00305 14-3-3 protein
IPR000308 126 150 PR00305 14-3-3 protein
HMMPfam IPR000308 47 142 PF00244 14-3-3 protein
HMMSmart IPR000308 47 180 SM00101 14-3-3 protein
ScanRegExp IPR000308 85 95 PS00796 14-3-3 protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp