ORK07550

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07550

Order Kazusa clone(s) from :

Accession No	AB209774
Product ID	ORK07550
Clone name	bm01750
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CELF4
cDNA sequence	DNA sequence (1910 bp) Predicted protein sequence (510 aa)
Description	bruno-like 4, RNA binding protein

Features of the cloned cDNA sequence

Description

Length: 1910 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	262 bp
Genome contig ID	gi51511735r_32978941
PolyA signal sequence (AATATA,-18)	+--------+--------+----*----+---- GCACGTGTTTGGGGGAAAATATATATGACATGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAGATGAAGAAAAATGAGAAAAAAACACACAAAAGGCAACTTTAAAA

Features of the protein sequence

Description

Length: 510 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93011	5.2e-164	100.0	bruno-like 4, R...	Homo sapiens
NP_001020258	6.1e-156	100.0	CUG-BP- and ETR...	Homo sapiens
Q5NVC8	2.4e-155	99.7	CUG-BP- and ETR...	Pongo abelii
Q7TSY6	5.5e-155	99.5	CUG-BP- and ETR...	Mus musculus
EDK97013	5.5e-155	98.7	bruno-like 4, R...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	81	155	PF00076	RNA recognition motif
	IPR000504	179	250	PF00076	RNA recognition motif
	IPR000504	467	498	PF00076	RNA recognition motif
HMMSmart	IPR000504	80	156	SM00360	RNA recognition motif
	IPR000504	178	253	SM00360	RNA recognition motif
	IPR000504	446	499	SM00360	RNA recognition motif
ProfileScan	IPR000504	79	160	PS50102	RNA recognition motif
	IPR000504	177	257	PS50102	RNA recognition motif
	IPR000504	446	503	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp