Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07557
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209827
Product ID ORK07557
Clone name bm05002
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CPNE1
cDNA sequence DNA sequence (1937 bp)
Predicted protein sequence (517 aa)
Description Homo sapiens mRNA for copine I variant protein.
Features of the cloned cDNA sequence

Length: 1937 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 195 bp
Genome contig ID gi51511747r_33577382
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGACAACCCTCATTCAATAAAGACCAGTGAAGACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGCTTTGCCACCACTCTCTTGTGTGTTTTTAGGTAGGAGGCTGCTATG

Features of the protein sequence

Length: 517 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93064 0 100.0 copine I varian...
Homo sapiens
EAW76181 0 100.0 hCG38213, isofo...
Homo sapiens
XP_864737 4.7e-211 93.5 similar to Copi...
Canis lupus fam...
XP_864903 4.7e-211 93.5 similar to Copi...
Canis lupus fam...
XP_864829 4.2e-197 88.7 similar to Copi...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000008 11 102 PF00168 C2 calcium-dependent membrane targeting
IPR000008 132 208 PF00168 C2 calcium-dependent membrane targeting
IPR010734 284 431 PF07002 Copine
HMMSmart IPR000008 10 117 SM00239 C2 calcium-dependent membrane targeting
IPR000008 128 223 SM00239 C2 calcium-dependent membrane targeting
IPR002035 263 465 SM00327 von Willebrand factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp