Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07583
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209379
Product ID ORK07583
Clone name fh18774
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LRWD1
cDNA sequence DNA sequence (5490 bp)
Predicted protein sequence (245 aa)
Description Homo sapiens mRNA for hypothetical protein DKFZp434K1815 variant protein.
Features of the cloned cDNA sequence

Length: 5490 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4610 bp
Genome contig ID gi89161213f_101792475
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
AGTGAATATTTTTATTAAACTCTACTGTGGACAAG
Flanking genome sequence
(108145 - 108194)
----+----*----+----*----+----*----+----*----+----*
AAGCCTGTGGAAAGGTGTTTCGAGTTATGCAGGAAGAAGTGTTCCTGCTT

Features of the protein sequence

Length: 245 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92616 1e-89 100.0 hypothetical pr...
Homo sapiens
XP_519556 2.5e-70 87.4 hypothetical pr...
Pan troglodytes
Q9UFC0 4.9e-70 86.0 Leucine-rich re...
Homo sapiens
BAF83656 4.9e-70 86.0 unnamed protein...
Homo sapiens
XP_001108941 2.5e-68 83.8 similar to C56E...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 27 40 PR00019 Leucine-rich repeat
IPR001611 46 59 PR00019 Leucine-rich repeat
HMMPfam IPR001611 26 44 PF00560 Leucine-rich repeat
IPR001611 70 91 PF00560 Leucine-rich repeat
HMMSmart IPR003591 24 47 SM00369 Leucine-rich repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp