ORK07583

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07583

Order Kazusa clone(s) from :

Accession No	AB209379
Product ID	ORK07583
Clone name	fh18774
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LRWD1
cDNA sequence	DNA sequence (5490 bp) Predicted protein sequence (245 aa)
Description	Homo sapiens mRNA for hypothetical protein DKFZp434K1815 variant protein.

Features of the cloned cDNA sequence

Description

Length: 5490 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4610 bp
Genome contig ID	gi89161213f_101792475
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AGTGAATATTTTTATTAAACTCTACTGTGGACAAG
Flanking genome sequence (108145 - 108194)	----+--------+--------+--------+--------+----* AAGCCTGTGGAAAGGTGTTTCGAGTTATGCAGGAAGAAGTGTTCCTGCTT

Features of the protein sequence

Description

Length: 245 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92616	1e-89	100.0	hypothetical pr...	Homo sapiens
XP_519556	2.5e-70	87.4	hypothetical pr...	Pan troglodytes
Q9UFC0	4.9e-70	86.0	Leucine-rich re...	Homo sapiens
BAF83656	4.9e-70	86.0	unnamed protein...	Homo sapiens
XP_001108941	2.5e-68	83.8	similar to C56E...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	27	40	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	46	59	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	26	44	PF00560	Leucine-rich repeat
HMMPfam	IPR001611	70	91	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	24	47	SM00369	Leucine-rich repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp