ORK07589

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07589

Order Kazusa clone(s) from :

Accession No	AB209178
Product ID	ORK07589
Clone name	fj00292
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHGA6
cDNA sequence	DNA sequence (4774 bp) Predicted protein sequence (950 aa)
Description	Homo sapiens mRNA for protocadherin gamma subfamily A, 6 isoform 1 precursor variant protein.

Features of the cloned cDNA sequence

Description

Length: 4774 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1805 bp
Genome contig ID	gi51511721f_140633665
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACAAAAAAATAATAAAACGTTTCTTCTGAAAAGCT
Flanking genome sequence (239066 - 239115)	----+--------+--------+--------+--------+----* GAACGTTTCTGTATAAGCGATGGAAGCTCCTGGCATGTGTGCATGAAGTG

Features of the protein sequence

Description

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92415	100.0	protocadherin g...	Homo sapiens
Q9Y5G7	99.8	Protocadherin g...	Homo sapiens
NP_001076033	99.3	protocadherin g...	Pan troglodytes
Q5DRB4	99.3	Protocadherin g...	Pan troglodytes
AAD43773	99.0	protocadherin g...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	91	110	PR00205	Cadherin
	IPR002126	260	289	PR00205	Cadherin
	IPR002126	332	344	PR00205	Cadherin
	IPR002126	344	363	PR00205	Cadherin
	IPR002126	468	481	PR00205	Cadherin
	IPR002126	528	554	PR00205	Cadherin
	IPR002126	562	579	PR00205	Cadherin
HMMPfam	IPR013164	47	130	PF08266	Cadherin
	IPR002126	156	251	PF00028	Cadherin
	IPR002126	265	356	PF00028	Cadherin
	IPR002126	370	461	PF00028	Cadherin
	IPR002126	475	571	PF00028	Cadherin
	IPR002126	600	683	PF00028	Cadherin
HMMSmart	IPR002126	63	149	SM00112	Cadherin
	IPR002126	173	258	SM00112	Cadherin
	IPR002126	282	363	SM00112	Cadherin
	IPR002126	387	468	SM00112	Cadherin
	IPR002126	492	578	SM00112	Cadherin
	IPR002126	609	687	SM00112	Cadherin
ProfileScan	IPR002126	93	151	PS50268	Cadherin
	IPR002126	152	260	PS50268	Cadherin
	IPR002126	261	365	PS50268	Cadherin
	IPR002126	373	470	PS50268	Cadherin
	IPR002126	471	580	PS50268	Cadherin
	IPR002126	597	700	PS50268	Cadherin
ScanRegExp	IPR002126	139	149	PS00232	Cadherin
	IPR002126	248	258	PS00232	Cadherin
	IPR002126	353	363	PS00232	Cadherin
	IPR002126	458	468	PS00232	Cadherin
	IPR002126	568	578	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	31	QVLLLTLLGTLWGAAAAQIRYSI	53	SECONDARY	23
SOSUI2	2	710	YLVVAVAAVSCVFLAFVIVLLAL	732	PRIMARY	23