ORK07601

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07601

Order Kazusa clone(s) from :

Accession No	AB208925
Product ID	ORK07601
Clone name	fj15089
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHA4
cDNA sequence	DNA sequence (4163 bp) Predicted protein sequence (921 aa)
Description	Homo sapiens mRNA for protocadherin alpha 4 isoform 1 precursor variant protein.

Features of the cloned cDNA sequence

Description

Length: 4163 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1343 bp
Genome contig ID	gi51511721f_140066843
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- GTATGAAAGACACAGTAAAATTTCTTTCTTAAATC
Flanking genome sequence (304507 - 304556)	----+--------+--------+--------+--------+----* AAGATACTGGTGATTCAAGGAATTTTATTTATGGTCCAGCCAAGAGCCAT

Features of the protein sequence

Description

Length: 921 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92162	100.0	protocadherin a...	Homo sapiens
Q9UN74	100.0	Protocadherin a...	Homo sapiens
EAW62013	99.6	hCG1982192, iso...	Homo sapiens
Q5DRE8	99.2	Protocadherin a...	Pan troglodytes
BAE43859	96.4	Protocadherin a...	Macaca fuscata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	93	112	PR00205	Cadherin
	IPR002126	262	291	PR00205	Cadherin
	IPR002126	440	452	PR00205	Cadherin
	IPR002126	454	473	PR00205	Cadherin
	IPR002126	473	486	PR00205	Cadherin
	IPR002126	533	559	PR00205	Cadherin
	IPR002126	567	584	PR00205	Cadherin
HMMPfam	IPR013164	49	132	PF08266	Cadherin
	IPR002126	158	253	PF00028	Cadherin
	IPR002126	267	361	PF00028	Cadherin
	IPR002126	375	466	PF00028	Cadherin
	IPR002126	480	576	PF00028	Cadherin
	IPR002126	593	690	PF00028	Cadherin
HMMSmart	IPR002126	65	151	SM00112	Cadherin
	IPR002126	175	260	SM00112	Cadherin
	IPR002126	284	368	SM00112	Cadherin
	IPR002126	392	473	SM00112	Cadherin
	IPR002126	497	583	SM00112	Cadherin
	IPR002126	614	696	SM00112	Cadherin
ProfileScan	IPR002126	48	153	PS50268	Cadherin
	IPR002126	154	262	PS50268	Cadherin
	IPR002126	263	370	PS50268	Cadherin
	IPR002126	371	475	PS50268	Cadherin
	IPR002126	476	585	PS50268	Cadherin
	IPR002126	608	698	PS50268	Cadherin
ScanRegExp	IPR002126	141	151	PS00232	Cadherin
	IPR002126	250	260	PS00232	Cadherin
	IPR002126	358	368	PS00232	Cadherin
	IPR002126	463	473	PS00232	Cadherin
	IPR002126	573	583	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	34	LLLLLLLLAAWEAGNGQLHYSVS	56	SECONDARY	23
SOSUI2	2	713	LVDVNVYLIIAICAVSSLLVLTL	735	PRIMARY	23