ORK07665

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07665

Order Kazusa clone(s) from :

Accession No	AB209067
Product ID	ORK07665
Clone name	hk01079
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CELF5
cDNA sequence	DNA sequence (4268 bp) Predicted protein sequence (421 aa)
Description	bruno-like 5, RNA binding protein

Features of the cloned cDNA sequence

Description

Length: 4268 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3002 bp
Genome contig ID	gi42406306f_3075748
PolyA signal sequence (AAGAAA,-7)	+--------+--------+----*----+---- ATAAGCTCAAAAGAAAAAAACATTTAAAAAGAAAG
Flanking genome sequence (171588 - 171637)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAACCAAGCATTTCCTTTTCTTTCTACCAAAATG

Features of the protein sequence

Description

Length: 421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92304	1.7e-154	100.0	bruno-like 5, R...	Homo sapiens
Q8N6W0	1.3e-108	93.6	CUG-BP- and ETR...	Homo sapiens
AAK07476	1.4e-108	93.4	CUG-BP and ETR-...	Homo sapiens
AAH47522	5.3e-106	92.1	BRUNOL5 protein...	Homo sapiens
NP_795928	2.7e-91	89.6	CUG-BP- and ETR...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	59	131	PF00076	RNA recognition motif
HMMPfam	IPR000504	148	219	PF00076	RNA recognition motif
HMMSmart	IPR000504	58	134	SM00360	RNA recognition motif
HMMSmart	IPR000504	147	222	SM00360	RNA recognition motif
ProfileScan	IPR000504	57	138	PS50102	RNA recognition motif
ProfileScan	IPR000504	146	226	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp