Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07665
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209067
Product ID ORK07665
Clone name hk01079
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CELF5
cDNA sequence DNA sequence (4268 bp)
Predicted protein sequence (421 aa)
Description bruno-like 5, RNA binding protein
Features of the cloned cDNA sequence

Length: 4268 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3002 bp
Genome contig ID gi42406306f_3075748
PolyA signal sequence
(AAGAAA,-7)
+----*----+----*----+----*----+----
ATAAGCTCAAAAGAAAAAAACATTTAAAAAGAAAG
Flanking genome sequence
(171588 - 171637)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAACCAAGCATTTCCTTTTCTTTCTACCAAAATG

Features of the protein sequence

Length: 421 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92304 1.7e-154 100.0 bruno-like 5, R...
Homo sapiens
Q8N6W0 1.3e-108 93.6 CUG-BP- and ETR...
Homo sapiens
AAK07476 1.4e-108 93.4 CUG-BP and ETR-...
Homo sapiens
AAH47522 5.3e-106 92.1 BRUNOL5 protein...
Homo sapiens
NP_795928 2.7e-91 89.6 CUG-BP- and ETR...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 59 131 PF00076 RNA recognition motif
IPR000504 148 219 PF00076 RNA recognition motif
HMMSmart IPR000504 58 134 SM00360 RNA recognition motif
IPR000504 147 222 SM00360 RNA recognition motif
ProfileScan IPR000504 57 138 PS50102 RNA recognition motif
IPR000504 146 226 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp