ORK07696

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07696

Order Kazusa clone(s) from :

Accession No	AB209434
Product ID	ORK07696
Clone name	pj00587
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CELF6
cDNA sequence	DNA sequence (4374 bp) Predicted protein sequence (305 aa)
Description	Homo sapiens mRNA for BRUNO-like 6 RNA-binding protein variant protein.

Features of the cloned cDNA sequence

Description

Length: 4374 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1644 bp
Genome contig ID	gi51511731r_70264122
PolyA signal sequence (AAGAAA,-23)	+--------+--------+----*----+---- ATAACAGTTTCTAAGAAAACTTGTTCCCACCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCTGTCTTCGACTCATTTTTGGAGGGAATGGGAATGAAACATAGATCT

Features of the protein sequence

Description

Length: 305 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92671	9.3e-100	100.0	BRUNO-like 6 RN...	Homo sapiens
BAG58778	4.4e-81	100.0	unnamed protein...	Homo sapiens
BAG57639	1.1e-72	90.7	unnamed protein...	Homo sapiens
BAC28635	1.3e-69	86.8	unnamed protein...	Mus musculus
Q7TN33	1.6e-69	86.8	CUG-BP- and ETR...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	222	293	PF00076	RNA recognition motif
HMMSmart	IPR000504	221	294	SM00360	RNA recognition motif
ProfileScan	IPR000504	220	298	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp