ORK08263

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK08263

Order Kazusa clone(s) from :

Accession No
Product ID	ORK08263
Clone name	bm03163
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	IMPDH2
cDNA sequence	DNA sequence (1633 bp) Predicted protein sequence (526 aa)
HaloTag ORF Clone	FHC08263
Flexi ORF Clone	FXC08263
Description	IMP (inosine monophosphate) dehydrogenase 2

Features of the cloned cDNA sequence

Description

Length: 1633 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	52 bp
Genome contig ID	gi89161205r_48936795
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CTCCTCGGTTTTTTTTTCAATAAAAGTTTAGAAAG
Flanking genome sequence (99973 - 99924)	----+--------+--------+--------+--------+----* AAAAAAGTGATGCCTGATCTTTCAACAGACAGGTGGGGCTCTGTAGCTGC

Features of the protein sequence

Description

Length: 526 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW64946	4.8e-206	100.0	hCG2002013, iso...	Homo sapiens
P12268	7.3e-201	100.0	Inosine-5'-mono...	Homo sapiens
XP_001494600	8.3e-201	98.2	similar to hCG2...	Equus caballus
XP_001110855	4.8e-200	99.6	inosine monopho...	Macaca mulatta
AAA36112	6.4e-200	99.6	inosine-5'-mono...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001093	40	516	PF00478	IMP dehydrogenase/GMP reductase
HMMPfam	IPR000644	124	244	PF00571	Cystathionine beta-synthase
HMMSmart	IPR000644	129	180	SM00116	Cystathionine beta-synthase
HMMSmart	IPR000644	196	244	SM00116	Cystathionine beta-synthase
HMMTigr	IPR005990	41	493	TIGR01302	IMP dehydrogenase
ScanRegExp	IPR015875	333	345	PS00487	IMP dehydrogenase / GMP reductase site

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp