Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10381
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10381
Clone name bm03306
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol BCKDK
cDNA sequence DNA sequence (1790 bp)
Predicted protein sequence (451 aa)
Flexi ORF Clone FXC10381
Description [3-methyl-2-oxobutanoate dehydrogenase [lipoamide]] kinase, mitochondrial Precursor (EC 2.7.11.4)(Branched-chain alpha-ketoacid dehydrogenase kinase)(BCKD-kinase)(BCKDHKIN)
Features of the cloned cDNA sequence

Length: 1790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 301 bp
Genome contig ID gi51511732f_30927229
PolyA signal sequence
(ATTAAA,-24)		 
+----*----+----*----+----*----+----
TCTGACCTGTTATTAAAGTTCACATTTTGAATGCC
Flanking genome sequence
(104161 - 104210)		 
----+----*----+----*----+----*----+----*----+----*
CTCTCGGGCCCCGTGTGTGGGGAGGGCAGGTGAACTTTTGTTTCTGCCCC

Features of the protein sequence

Length: 451 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O14874 7.1e-169 100.0 [3-methyl-2-oxo...
 Homo sapiens
AAQ02398 7.1e-169 100.0 branched chain ...
 synthetic construct
AAB82714 1.7e-168 99.7 branched chain ...
 Homo sapiens
XP_001156184 3.6e-168 99.7 branched chain ...
 Pan troglodytes
BAB64516 2.9e-165 98.0 hypothetical pr...
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR004358 348 362 PR00344 Histidine kinase related protein
IPR004358 403 421 PR00344 Histidine kinase related protein
IPR004358 427 440 PR00344 Histidine kinase related protein
HMMPfam IPR003594 303 442 PF02518 ATP-binding region
HMMSmart IPR003594 303 443 SM00387 ATP-binding region
ProfileScan IPR005467 308 443 PS50109 Histidine kinase
ScanRegExp IPR000276 24 40 PS00237 Rhodopsin-like GPCR superfamily
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp