ORK10383

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10383

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10383
Clone name	bm04279
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RAE1
cDNA sequence	DNA sequence (1619 bp) Predicted protein sequence (413 aa)
HaloTag ORF Clone	FHC10383
Flexi ORF Clone	FXC10383
Description	mRNA export factor (mRNA-associated protein mrnp 41)(Rae1 protein homolog)

Features of the cloned cDNA sequence

Description

Length: 1619 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	358 bp
Genome contig ID	gi51511747f_55259739
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GCTGTATTTTGTAATAAAGTCTTTTGCAGATTGCT
Flanking genome sequence (127183 - 127232)	----+--------+--------+--------+--------+----* TCCCGAGCTTCCTTTGTCCTTTTCTCCCCTTGCCCACCCCGTAACCTCAG

Features of the protein sequence

Description

Length: 413 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P78406	1.7e-162	100.0	mRNA export fac...	Homo sapiens
AAR04856	3.6e-162	99.7	RNA export 1-li...	Homo sapiens
A5GFN6	6.6e-162	99.4	mRNA export fac...	Sus scrofa
XP_543066	1e-161	99.1	similar to RAE1...	Canis lupus fam...
Q5E9A4	2.6e-161	98.6	mRNA export fac...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	130	160	PD000018	WD40 repeat
BlastProDom	IPR001680	168	202	PD000018	WD40 repeat
FPrintScan	IPR001680	146	160	PR00320	WD40 repeat
	IPR001680	189	203	PR00320	WD40 repeat
	IPR001680	333	347	PR00320	WD40 repeat
HMMPfam	IPR001680	74	115	PF00400	WD40 repeat
	IPR001680	121	159	PF00400	WD40 repeat
	IPR001680	162	202	PF00400	WD40 repeat
	IPR001680	320	346	PF00400	WD40 repeat
HMMSmart	IPR001680	73	115	SM00320	WD40 repeat
	IPR001680	121	159	SM00320	WD40 repeat
	IPR001680	162	202	SM00320	WD40 repeat
	IPR001680	295	346	SM00320	WD40 repeat
ProfileScan	IPR001680	80	211	PS50294	WD40 repeat
	IPR001680	127	168	PS50082	WD40 repeat
	IPR001680	168	211	PS50082	WD40 repeat
	IPR001680	321	355	PS50082	WD40 repeat
ScanRegExp	IPR001680	146	160	PS00678	WD40 repeat
ScanRegExp	IPR001680	189	203	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	GGFGLLGFLSALLALVLR	18	PRIMARY	18