Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10416
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10416
Clone name fj03879s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TRIOBP
cDNA sequence DNA sequence (7661 bp)
Predicted protein sequence (2374 aa)
Flexi ORF Clone FXC10416
Description TRIO and F-actin-binding protein (Protein Tara)(Trio-associated repeat on actin)
Features of the cloned cDNA sequence

Length: 7661 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 345 bp
Genome contig ID gi89161203f_36322994
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTTTTCCTTTTTTTCCAAAACACTTTATACTTT
Flanking genome sequence
(177084 - 177133)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGCAATTCCTGGTGGCTGTGTGCCTCCAACCCTG

Features of the protein sequence

Length: 2374 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9H2D6 0 99.7 TRIO and F-acti...
Homo sapiens
ABB59559 0 99.7 TRIOBP isoform ...
Homo sapiens
XP_515120 0 90.7 TRIO and F-acti...
Pan troglodytes
ABB77204 0 95.4 trio-associated...
Homo sapiens
EAW60185 0 99.8 TRIO and F-acti...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 1788 1896 PF00169 Pleckstrin-like
HMMSmart IPR001849 1788 1898 SM00233 Pleckstrin-like
ProfileScan IPR001849 1787 1896 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp