ORK10436

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10436

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10436
Clone name	pf01112
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RAB30
cDNA sequence	DNA sequence (1129 bp) Predicted protein sequence (203 aa)
HaloTag ORF Clone	FHC10436
Flexi ORF Clone	FXC10436
Description	Ras-related protein Rab-30

Features of the cloned cDNA sequence

Description

Length: 1129 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	349 bp
Genome contig ID	gi51511727r_82270506
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGAAATGTACTGTAGGGATCCCTCCTGCACATCA
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTGGGTGCATGTGGGAACTCTTCTTTAGGGCTTCGGTGGTAATCATCTGG

Features of the protein sequence

Description

Length: 203 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15771	7.4e-82	100.0	Ras-related pro...	Homo sapiens
XP_001377113	1.9e-81	99.5	similar to RAB3...	Monodelphis dom...
AAC50774	3e-81	99.5	Rab30 [Homo sap...	Homo sapiens
BAB30625	4.8e-81	99.5	unnamed protein...	Mus musculus
XP_002187756	7.8e-81	98.5	similar to RAB3...	Taeniopygia guttata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	10	31	PR00449	Ras GTPase
	IPR001806	33	49	PR00449	Ras GTPase
	IPR001806	51	73	PR00449	Ras GTPase
	IPR001806	113	126	PR00449	Ras GTPase
	IPR001806	148	170	PR00449	Ras GTPase
HMMPfam	IPR013753	11	172	PF00071	Ras
HMMSmart	IPR003577	7	173	SM00173	Ras small GTPase
	IPR003579	10	173	SM00175	Ras small GTPase
	IPR003578	12	174	SM00174	Ras small GTPase
	IPR002041	15	194	SM00176	Ran GTPase
HMMTigr	IPR005225	7	168	TIGR00231	Small GTP-binding protein domain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp