ORK10527

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10527

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10527
Clone name	ff06095
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RNF14
cDNA sequence	DNA sequence (4520 bp) Predicted protein sequence (373 aa)
HaloTag ORF Clone	FHC10527
Flexi ORF Clone	FXC10527
Description	ring finger protein 14

Features of the cloned cDNA sequence

Description

Length: 4520 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1397 bp
Genome contig ID	gi51511721f_141183612
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- AATAAAAATAAATTTAAAAATCATCTTATAATTAG
Flanking genome sequence (165326 - 165375)	----+--------+--------+--------+--------+----* AACAGAGTTGCTGCTATTTGTTCTGTCACCAAGGCAACTAATCACATTTT

Features of the protein sequence

Description

Length: 373 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UBS8	3.1e-164	100.0	E3 ubiquitin-pr...	Homo sapiens
CAG32983	3.1e-164	100.0	RNF14 [Homo sap...	Homo sapiens
XP_527056	5.7e-164	99.7	ring finger pro...	Pan troglodytes
XP_001152699	6.1e-164	99.7	ring finger pro...	Pan troglodytes
BAG51217	1.2e-163	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006575	2	33	PF05773	RWD
	IPR001841	119	164	PF00097	Zinc finger
	IPR002867	188	249	PF01485	Zinc finger
HMMSmart	IPR002867	188	249	SM00647	Zinc finger
HMMSmart	IPR002867	285	352	SM00647	Zinc finger
ProfileScan	IPR001841	119	164	PS50089	Zinc finger
ScanRegExp	IPR001841	137	146	PS00518	Zinc finger
ScanRegExp	IPR006058	223	231	PS00197	2Fe-2S ferredoxin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp