ORK11484

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11484

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11484
Clone name	fg03474
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCBP4
cDNA sequence	DNA sequence (6128 bp) Predicted protein sequence (470 aa)
HaloTag ORF Clone	FHC11484
Flexi ORF Clone	FXC11484
Description	poly(rC) binding protein 4

Features of the cloned cDNA sequence

Description

Length: 6128 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	601 bp
Genome contig ID	gi89161205r_51866516
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCAATCCCTGTTTTTGAATAAATATTCTCAGCGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAGGAAGTTGTGAAATACTGGTGTTGTGGGCAGCAAAACCTCCAGAAAAT

Features of the protein sequence

Description

Length: 470 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001170874	1.1e-144	100.0	poly(rC) bindin...	Pan troglodytes
P57723	3.2e-137	100.0	Poly(rC)-bindin...	Homo sapiens
XP_001094397	1.3e-136	99.5	poly(rC) bindin...	Macaca mulatta
XP_849987	6.2e-135	98.0	similar to Poly...	Canis lupus fam...
XP_001171145	2.4e-134	100.0	poly(rC) bindin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	86	146	PF00013	K Homology
	IPR004088	170	233	PF00013	K Homology
	IPR004088	310	372	PF00013	K Homology
HMMSmart	IPR004087	83	151	SM00322	K Homology
	IPR004087	167	238	SM00322	K Homology
	IPR004087	307	377	SM00322	K Homology
ProfileScan	IPR004088	84	146	PS50084	K Homology
	IPR004088	168	233	PS50084	K Homology
	IPR004088	308	372	PS50084	K Homology

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp