ORK11565

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11565

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11565
Clone name	bm01735
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	FDFT1
cDNA sequence	DNA sequence (1464 bp) Predicted protein sequence (430 aa)
HaloTag ORF Clone	FHC11565
Flexi ORF Clone	FXC11565
Description	farnesyl-diphosphate farnesyltransferase 1

Features of the cloned cDNA sequence

Description

Length: 1464 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	170 bp
Genome contig ID	gi51511724f_11597711
PolyA signal sequence (None)	+--------+--------+----*----+---- GGAAAGTGAAATGCAGGTGAGAAGAACCTAAACAT
Flanking genome sequence (135988 - 136037)	----+--------+--------+--------+--------+----* GAAAGGAAAGGGTGCCTCATCCCAGCAACCTGTCCTTGTGGGTGATGATC

Features of the protein sequence

Description

Length: 430 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P37268	1.5e-178	100.0	Squalene synthe...	Homo sapiens
AAP36671	1.5e-178	100.0	farnesyl-diphos...	synthetic construct
AAH09251	2.4e-178	99.7	Farnesyl-diphos...	Homo sapiens
CAA48896	3.3e-178	99.7	farnesyl-diphos...	Homo sapiens
AAB33404	6.1e-178	99.5	squalene syntha...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002060	60	347	PF00494	Squalene/phytoene synthase
HMMTigr	IPR006449	51	383	TIGR01559	Farnesyl-diphosphate farnesyltransferase
ScanRegExp	IPR002060	184	199	PS01044	Squalene/phytoene synthase
ScanRegExp	IPR002060	220	245	PS01045	Squalene/phytoene synthase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	393	SHYSPIYLSFVMLLAALSWQYLT	415	PRIMARY	23