Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11590
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11590
Clone name bm02517
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HAPLN1
cDNA sequence DNA sequence (1860 bp)
Predicted protein sequence (364 aa)
Flexi ORF Clone FXC11590
Description hyaluronan and proteoglycan link protein 1
Features of the cloned cDNA sequence

Length: 1860 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 569 bp
Genome contig ID gi51511721r_82872502
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
AATATTTTACTCTTTAAAATCCTGCCTTTCTGACC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAATTCATATGGATTCCAATCCATAGTAACAAGCAC

Features of the protein sequence

Length: 364 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P10915 3.8e-161 100.0 Hyaluronan and ...
 Homo sapiens
AAH57808 1.6e-160 99.7 HAPLN1 protein ...
 Homo sapiens
XP_517666 1.6e-160 99.4 cartilage linki...
 Pan troglodytes
XP_001112341 6.9e-159 98.0 cartilage linki...
 Macaca mulatta
BAE87564 1.6e-157 97.7 unnamed protein...
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000538 149 217 PD000918 Link
IPR000538 248 316 PD000918 Link
FPrintScan IPR000538 179 191 PR01265 Link
IPR000538 207 220 PR01265 Link
IPR000538 225 236 PR01265 Link
IPR000538 258 267 PR01265 Link
HMMPfam IPR013106 63 164 PF07686 Immunoglobulin V-set
IPR000538 168 263 PF00193 Link
IPR000538 269 360 PF00193 Link
HMMSmart IPR003599 56 167 SM00409 Immunoglobulin subtype
IPR003596 66 151 SM00406 Immunoglobulin V-set
IPR000538 167 264 SM00445 Link
IPR000538 268 361 SM00445 Link
ProfileScan IPR007110 48 162 PS50835 Immunoglobulin-like
IPR000538 169 264 PS50963 Link
IPR000538 269 361 PS50963 Link
ScanRegExp IPR000538 191 236 PS01241 Link
IPR000538 289 335 PS01241 Link
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp