ORK11634

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11634

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11634
Clone name	eh00660
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	OSMR
cDNA sequence	DNA sequence (5459 bp) Predicted protein sequence (983 aa)
HaloTag ORF Clone	FHC11634
Flexi ORF Clone	FXC11634
Description	oncostatin M receptor

Features of the cloned cDNA sequence

Description

Length: 5459 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2182 bp
Genome contig ID	gi51511721f_38781923
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCATTTTTGCTATTGAAATAAACCTTAATTAAAAT
Flanking genome sequence (189567 - 189616)	----+--------+--------+--------+--------+----* ATTTCATCATCACATTGTGTTTTATCTCCCTCAATGAAATGAAAATCTAG

Features of the protein sequence

Description

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99650	100.0	Oncostatin-M-sp...	Homo sapiens
XP_001141406	99.0	oncostatin M re...	Pan troglodytes
XP_001083745	94.5	similar to onco...	Macaca mulatta
XP_001497043	75.4	oncostatin M re...	Equus caballus
XP_546341	72.2	similar to onco...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003961	438	522	PF00041	Fibronectin
	IPR003961	543	614	PF00041	Fibronectin
	IPR003961	626	730	PF00041	Fibronectin
HMMSmart	IPR003961	337	417	SM00060	Fibronectin
	IPR003961	435	519	SM00060	Fibronectin
	IPR003961	527	614	SM00060	Fibronectin
	IPR003961	626	727	SM00060	Fibronectin
ProfileScan	IPR003961	336	428	PS50853	Fibronectin
	IPR003961	434	528	PS50853	Fibronectin
	IPR003961	530	623	PS50853	Fibronectin
	IPR003961	629	736	PS50853	Fibronectin
ScanRegExp	IPR001005	136	144	PS00037	SANT
ScanRegExp	IPR003529	514	565	PS01353	Long hematopoietin receptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	LMALFAVFQTTFFLTLLSLR	23	SECONDARY	20
SOSUI2	2	744	MLIHILLPMVFCVLLIMVMCYLK	766	PRIMARY	23