ORK11784

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11784

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11784
Clone name	bm04280
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SMAP2
cDNA sequence	DNA sequence (2620 bp) Predicted protein sequence (464 aa)
HaloTag ORF Clone	FHC11784
Flexi ORF Clone	FXC11784
Description	Stromal membrane-associated protein 2 (Stromal membrane-associated protein 1-like)

Features of the cloned cDNA sequence

Description

Length: 2620 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1225 bp
Genome contig ID	gi89161185f_40512275
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTGTAAATTCCTTAATAAATATTGCAGGGAAGGAC
Flanking genome sequence (149312 - 149361)	----+--------+--------+--------+--------+----* TGTTTGCTTGGCCATTACTGTGCGTCACTCTTGGAGGAGGGTGCGTTACA

Features of the protein sequence

Description

Length: 464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_513355	3.8e-154	97.4	stromal membran...	Pan troglodytes
XP_001083189	6.9e-153	96.7	similar to stro...	Macaca mulatta
Q8WU79	3.1e-147	100.0	Stromal membran...	Homo sapiens
BAG24503	1.5e-141	95.8	stromal membran...	Sus scrofa
Q7TN29	7.4e-141	95.5	Stromal membran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	60	79	PR00405	Arf GTPase activating protein
	IPR001164	79	96	PR00405	Arf GTPase activating protein
	IPR001164	100	121	PR00405	Arf GTPase activating protein
HMMPfam	IPR001164	48	166	PF01412	Arf GTPase activating protein
HMMSmart	IPR001164	48	166	SM00105	Arf GTPase activating protein
ProfileScan	IPR001164	48	172	PS50115	Arf GTPase activating protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp