ORK11788

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11788

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11788
Clone name	bm05505
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	H2AFY2
cDNA sequence	DNA sequence (1896 bp) Predicted protein sequence (374 aa)
HaloTag ORF Clone	FHC11788
Flexi ORF Clone	FXC11788
Description	Core histone macro-H2A.2 (Histone macroH2A2)(mH2A2)

Features of the cloned cDNA sequence

Description

Length: 1896 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	593 bp
Genome contig ID	gi89161187f_71382638
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GAAAGGAAAAAAATAAAAGATCCAGTGTCTTTCTT
Flanking genome sequence (159402 - 159451)	----+--------+--------+--------+--------+----* ACAACATATTCTTTTATTGCAACATTTTCCTCAGTTTGGAAAACTGTGTC

Features of the protein sequence

Description

Length: 374 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P0M6	6.1e-137	100.0	Core histone ma...	Homo sapiens
XP_001927061	9.3e-137	99.7	similar to Core...	Sus scrofa
XP_001109286	1.2e-136	99.7	core histone ma...	Macaca mulatta
AAI16137	1.9e-136	99.7	H2A histone fam...	Bos taurus
XP_861204	5.1e-136	99.1	similar to Core...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002119	37	119	PD000522	Histone H2A
FPrintScan	IPR002119	13	35	PR00620	Histone H2A
	IPR002119	42	57	PR00620	Histone H2A
	IPR002119	57	70	PR00620	Histone H2A
	IPR002119	71	85	PR00620	Histone H2A
	IPR002119	99	117	PR00620	Histone H2A
HMMPfam	IPR007125	17	90	PF00125	Histone core
HMMPfam	IPR002589	218	332	PF01661	Appr-1-p processing
HMMSmart	IPR002119	2	122	SM00414	Histone H2A
HMMSmart	IPR002589	198	332	SM00506	Appr-1-p processing
ProfileScan	IPR002589	186	372	PS51154	Appr-1-p processing

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp