Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11791
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11791
Clone name bm05752
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol UBE2D3
cDNA sequence DNA sequence (2114 bp)
Predicted protein sequence (155 aa)
Description Ubiquitin-conjugating enzyme E2 D3 (EC 6.3.2.19)(Ubiquitin-protein ligase D3)(Ubiquitin carrier protein D3)(Ubiquitin-conjugating enzyme E2-17 kDa 3)(E2(17)KB 3)
Features of the cloned cDNA sequence

Length: 2114 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1438 bp
Genome contig ID gi89161207r_103836218
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACTTAACATGAATGAATAAAAGTCAATGCTATTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTGTTTTTTGTTTGACAAGTGCTATCTGTGCCACTGATTTAACTTCTGT

Features of the protein sequence

Length: 155 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P61079 6.9e-66 100.0 Ubiquitin-conju...
Mus musculus
1X23 7.2e-66 100.0 Ubiquitin-conju...
Homo sapiens
AAH66917 1.1e-65 99.3 Ubiquitin-conju...
Homo sapiens
XP_001367781 1.1e-65 99.3 similar to ubiq...
Monodelphis dom...
BAE31970 1.6e-65 99.3 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000608 10 155 PD000461 Ubiquitin-conjugating enzyme
HMMPfam IPR000608 13 150 PF00179 Ubiquitin-conjugating enzyme
HMMSmart IPR000608 12 155 SM00212 Ubiquitin-conjugating enzyme
ProfileScan IPR000608 12 144 PS50127 Ubiquitin-conjugating enzyme
ScanRegExp IPR000608 82 97 PS00183 Ubiquitin-conjugating enzyme
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp