ORK11804

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11804

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11804
Clone name	ff03388
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF680
cDNA sequence	DNA sequence (10946 bp) Predicted protein sequence (537 aa)
HaloTag ORF Clone	FHC11804
Flexi ORF Clone	FXC11804
Description	Zinc finger protein 680

Features of the cloned cDNA sequence

Description

Length: 10946 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	9332 bp
Genome contig ID	gi89161213r_63490448
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCCTTAACTTTGGCAAATAAATTTCCTAAAATGAC
Flanking genome sequence (99590 - 99541)	----+--------+--------+--------+--------+----* TGAGATGTGTTTCGTTGTTTACTTCGACTGACATCTGGTAACCACAGAGG

Features of the protein sequence

Description

Length: 537 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_527766	0	98.6	zinc finger pro...	Pan troglodytes
Q8NEM1	0	100.0	Zinc finger pro...	Homo sapiens
AAH30700	0	99.6	Zinc finger pro...	Homo sapiens
ACE86773	0	99.4	zinc finger pro...	synthetic construct
EAW77967	7.5e-202	100.0	zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	189	212	PD000003	Zinc finger
	IPR007087	217	239	PD000003	Zinc finger
	IPR007087	273	296	PD000003	Zinc finger
	IPR007087	301	324	PD000003	Zinc finger
	IPR007087	329	352	PD000003	Zinc finger
	IPR007087	357	380	PD000003	Zinc finger
	IPR007087	385	408	PD000003	Zinc finger
	IPR007087	413	436	PD000003	Zinc finger
	IPR007087	441	464	PD000003	Zinc finger
	IPR007087	469	491	PD000003	Zinc finger
	IPR007087	497	520	PD000003	Zinc finger
HMMPfam	IPR001909	20	60	PF01352	KRAB box
	IPR007087	189	211	PF00096	Zinc finger
	IPR007087	217	239	PF00096	Zinc finger
	IPR007087	245	267	PF00096	Zinc finger
	IPR007087	273	295	PF00096	Zinc finger
	IPR007087	301	323	PF00096	Zinc finger
	IPR007087	329	351	PF00096	Zinc finger
	IPR007087	357	379	PF00096	Zinc finger
	IPR007087	385	407	PF00096	Zinc finger
	IPR007087	413	435	PF00096	Zinc finger
	IPR007087	441	463	PF00096	Zinc finger
	IPR007087	469	491	PF00096	Zinc finger
	IPR007087	497	519	PF00096	Zinc finger
HMMSmart	IPR001909	20	80	SM00349	KRAB box
	IPR015880	189	211	SM00355	Zinc finger
	IPR015880	217	239	SM00355	Zinc finger
	IPR015880	245	267	SM00355	Zinc finger
	IPR015880	273	295	SM00355	Zinc finger
	IPR015880	301	323	SM00355	Zinc finger
	IPR015880	329	351	SM00355	Zinc finger
	IPR015880	357	379	SM00355	Zinc finger
	IPR015880	385	407	SM00355	Zinc finger
	IPR015880	413	435	SM00355	Zinc finger
	IPR015880	441	463	SM00355	Zinc finger
	IPR015880	469	491	SM00355	Zinc finger
	IPR015880	497	519	SM00355	Zinc finger
ProfileScan	IPR001909	20	91	PS50805	KRAB box
	IPR007087	189	216	PS50157	Zinc finger
	IPR007087	217	244	PS50157	Zinc finger
	IPR007087	245	272	PS50157	Zinc finger
	IPR007087	273	300	PS50157	Zinc finger
	IPR007087	301	328	PS50157	Zinc finger
	IPR007087	329	356	PS50157	Zinc finger
	IPR007087	357	384	PS50157	Zinc finger
	IPR007087	385	412	PS50157	Zinc finger
	IPR007087	413	440	PS50157	Zinc finger
	IPR007087	441	468	PS50157	Zinc finger
	IPR007087	469	496	PS50157	Zinc finger
	IPR007087	497	524	PS50157	Zinc finger
ScanRegExp	IPR007087	191	211	PS00028	Zinc finger
	IPR007087	219	239	PS00028	Zinc finger
	IPR007087	247	267	PS00028	Zinc finger
	IPR007087	275	295	PS00028	Zinc finger
	IPR007087	303	323	PS00028	Zinc finger
	IPR007087	331	351	PS00028	Zinc finger
	IPR007087	359	379	PS00028	Zinc finger
	IPR007087	387	407	PS00028	Zinc finger
	IPR007087	415	435	PS00028	Zinc finger
	IPR007087	443	463	PS00028	Zinc finger
	IPR007087	471	491	PS00028	Zinc finger
	IPR007087	499	519	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp