ORK11819

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11819

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11819
Clone name	fk08386
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HNRNPA2B1
cDNA sequence	DNA sequence (3810 bp) Predicted protein sequence (407 aa)
Description	Heterogeneous nuclear ribonucleoproteins A2/B1 (hnRNP A2 / hnRNP B1)

Features of the cloned cDNA sequence

Description

Length: 3810 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2584 bp
Genome contig ID	gi89161213r_26096078
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATTGGCTGTCCCCAATAAAATGCTGTTCATTATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGTATATTCAGCGTTTGAGTACTCCTAAAGTTTCTGGCTTTACTTTTA

Features of the protein sequence

Description

Length: 407 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001473875	1.2e-120	94.7	similar to hete...	Mus musculus
XP_519003	3.7e-111	97.1	similar to Hete...	Pan troglodytes
Q2HJ60	5.5e-111	100.0	Heterogeneous n...	Bos taurus
AAK98601	1.1e-110	99.7	heterogeneous n...	Mus musculus
BAF79675	1.1e-110	99.7	heterogeneous n...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	77	147	PF00076	RNA recognition motif
HMMPfam	IPR000504	168	238	PF00076	RNA recognition motif
HMMSmart	IPR000504	76	148	SM00360	RNA recognition motif
HMMSmart	IPR000504	167	239	SM00360	RNA recognition motif
ProfileScan	IPR000504	75	158	PS50102	RNA recognition motif
ProfileScan	IPR000504	166	245	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp