Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11820
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11820
Clone name fk09943
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol VPS4B
cDNA sequence DNA sequence (1669 bp)
Predicted protein sequence (467 aa)
Description Vacuolar protein sorting-associating protein 4B (Suppressor of K(+) transport growth defect 1)(Protein SKD1)
Features of the cloned cDNA sequence

Length: 1669 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 264 bp
Genome contig ID gi51511735r_59108924
PolyA signal sequence
(AGTAAA,-9)
+----*----+----*----+----*----+----
GAACGGCATAAAAACAGAAATTACCCAGTAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GATGTCAGAAATTGACATACAAATATTTACAATTTTTATGAATGGTGGTC

Features of the protein sequence

Length: 467 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75351 1.2e-165 100.0 Vacuolar protei...
Homo sapiens
Q5R658 4.6e-165 99.5 Vacuolar protei...
Pongo abelii
BAF83621 4.6e-165 99.5 unnamed protein...
Homo sapiens
AAC39874 6e-165 99.3 SKD1 homolog [H...
Homo sapiens
BAF83942 1.4e-164 99.3 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007330 68 97 PF04212 MIT
IPR003959 192 377 PF00004 AAA ATPase
IPR015415 403 464 PF09336 Vps4 oligomerisation
HMMSmart IPR007330 27 105 SM00745 MIT
IPR003593 189 325 SM00382 AAA+ ATPase
ScanRegExp IPR003960 295 314 PS00674 AAA ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp