ORK07536

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07536

Order Kazusa clone(s) from :

Accession No	AB209166
Product ID	ORK07536
Clone name	ah00631
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HLA-DRA
cDNA sequence	DNA sequence (5774 bp) Predicted protein sequence (231 aa)
Description	major histocompatibility complex, class II, DR alpha precursor

Features of the cloned cDNA sequence

Description

Length: 5774 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5077 bp
Genome contig ID	gi89161205r_181126637
PolyA signal sequence (None)	+--------+--------+----*----+---- AGATTTCTTCAATTAATTGCCTATTCCCAAATTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGAATGCTGAAAGGCTTTTGATGACATTCA

Features of the protein sequence

Description

Length: 231 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92403	8.8e-100	100.0	major histocomp...	Homo sapiens
AAA59783	1.1e-71	96.6	cell surface gl...	Homo sapiens
P01903	1.1e-71	96.6	HLA class II hi...	Homo sapiens
EAX03629	1.1e-71	96.6	major histocomp...	Homo sapiens
CAP40290	1.5e-71	95.5	MHC class II an...	Pan troglodytes...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001003	45	125	PF00993	MHC class II
HMMPfam	IPR003597	134	186	PF07654	Immunoglobulin C1-set
HMMSmart	IPR003597	143	199	SM00407	Immunoglobulin C1-set
ProfileScan	IPR007110	128	167	PS50835	Immunoglobulin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp