ORK06281

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06281

Order Kazusa clone(s) from :

Accession No	AB209177
Product ID	ORK06281
Clone name	ah01984
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PAX6
cDNA sequence	DNA sequence (6174 bp) Predicted protein sequence (385 aa)
Description	Paired box protein Pax-6 (Oculorhombin) (Aniridia type II protein).

Features of the cloned cDNA sequence

Description

Length: 6174 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi51511727r_31668060
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCTGATATGTCTCAATACTGGCCAAGATTACAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAGGAAAGGAAATATTGTGTTAATTCAGT

Features of the protein sequence

Description

Length: 385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92414	1.7e-135	100.0	paired box gene...	Homo sapiens
XP_001085217	2.9e-132	100.0	similar to Pair...	Macaca mulatta
BAC25729	5.3e-132	99.7	unnamed protein...	Mus musculus
P26367	5.3e-132	99.7	Paired box prot...	Homo sapiens
EAW68233	5.6e-132	99.7	paired box gene...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	176	230	PD000010	Homeobox
FPrintScan	IPR001523	9	26	PR00027	Paired box protein
	IPR001523	27	44	PR00027	Paired box protein
	IPR001356	210	220	PR00024	Homeobox
	IPR001356	220	229	PR00024	Homeobox
HMMPfam	IPR001523	3	91	PF00292	Paired box protein
HMMPfam	IPR001356	174	230	PF00046	Homeobox
HMMSmart	IPR001523	4	91	SM00351	Paired box protein
HMMSmart	IPR001356	173	235	SM00389	Homeobox
ProfileScan	IPR001523	1	93	PS51057	Paired box protein
ProfileScan	IPR001356	171	231	PS50071	Homeobox
ScanRegExp	IPR001356	206	229	PS00027	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp