ORK01339

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01339

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01339
Clone name	aj00333
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHGB5
cDNA sequence	DNA sequence (4825 bp) Predicted protein sequence (938 aa)
Flexi ORF Clone	FXC01339
Description	Protocadherin gamma B5

Features of the cloned cDNA sequence

Description

Length: 4825 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1798 bp
Genome contig ID	gi51511721f_140647378
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTCTTCGACAAAAAAATAATAAAACGTTTCTTCTG
Flanking genome sequence (225346 - 225395)	----+--------+--------+--------+--------+----* AAAAGCTGAACGTTTCTGTATAAGCGATGGAAGCTCCTGGCATGTGTGCA

Features of the protein sequence

Description

Length: 938 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y5G0	100.0	Protocadherin g...	Homo sapiens
Q5DRA7	99.2	Protocadherin g...	Pan troglodytes
AAD43781	100.0	protocadherin g...	Homo sapiens
Q9UN71	85.6	Protocadherin g...	Homo sapiens
Q5DRA8	85.1	Protocadherin g...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	88	107	PR00205	Cadherin
	IPR002126	257	286	PR00205	Cadherin
	IPR002126	325	337	PR00205	Cadherin
	IPR002126	442	461	PR00205	Cadherin
	IPR002126	461	474	PR00205	Cadherin
	IPR002126	521	547	PR00205	Cadherin
	IPR002126	555	572	PR00205	Cadherin
HMMPfam	IPR013164	46	127	PF08266	Cadherin
	IPR002126	153	248	PF00028	Cadherin
	IPR002126	262	349	PF00028	Cadherin
	IPR002126	367	454	PF00028	Cadherin
	IPR002126	468	564	PF00028	Cadherin
	IPR002126	593	676	PF00028	Cadherin
HMMSmart	IPR002126	61	146	SM00112	Cadherin
	IPR002126	170	255	SM00112	Cadherin
	IPR002126	279	356	SM00112	Cadherin
	IPR002126	380	461	SM00112	Cadherin
	IPR002126	485	571	SM00112	Cadherin
	IPR002126	602	683	SM00112	Cadherin
ProfileScan	IPR002126	52	148	PS50268	Cadherin
	IPR002126	149	257	PS50268	Cadherin
	IPR002126	258	358	PS50268	Cadherin
	IPR002126	367	463	PS50268	Cadherin
	IPR002126	464	573	PS50268	Cadherin
	IPR002126	589	686	PS50268	Cadherin
ScanRegExp	IPR002126	136	146	PS00232	Cadherin
	IPR002126	245	255	PS00232	Cadherin
	IPR002126	346	356	PS00232	Cadherin
	IPR002126	451	461	PS00232	Cadherin
	IPR002126	561	571	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	26	AERLPVLFLFLLSLFCPALCEQI	48	PRIMARY	23
SOSUI2	2	702	YLVVALALISVLFLLAVILAVAL	724	PRIMARY	23