ORK07171

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07171

Order Kazusa clone(s) from :

Accession No	AB209762
Product ID	ORK07171
Clone name	bj00350
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TNFRSF11A
cDNA sequence	DNA sequence (3591 bp) Predicted protein sequence (321 aa)
Description	Tumor necrosis factor receptor superfamily member 11A precursor (Receptor activator of NF-KB) (Osteoclast differentiation factor receptor) (ODFR) (CD265 antigen).

Features of the cloned cDNA sequence

Description

Length: 3591 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2625 bp
Genome contig ID	gi51511735f_58066378
PolyA signal sequence (AATACA,-31)	+--------+--------+----*----+---- TTAAAATACAGCCTGGGTACCCAGTGAAAGAGCTG
Flanking genome sequence (139496 - 139545)	----+--------+--------+--------+--------+----* AAATGGAAATGGAGTATCATGTTTCCTACTCACATTTTACTCAGCTGTCG

Features of the protein sequence

Description

Length: 321 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92999	5.8e-138	100.0	tumor necrosis ...	Homo sapiens
Q9Y6Q6	4.1e-88	100.0	Tumor necrosis ...	Homo sapiens
XP_523949	8.6e-88	99.5	tumor necrosis ...	Pan troglodytes
AAH19185	4.2e-71	79.5	Tnfrsf11a prote...	Mus musculus
O35305	4.2e-71	79.5	Tumor necrosis ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001368	56	90	PF00020	TNFR/CD27/30/40/95 cysteine-rich region
HMMSmart	IPR001368	56	90	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	93	134	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	136	173	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	176	216	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
ProfileScan	IPR001368	55	90	PS50050	TNFR/CD27/30/40/95 cysteine-rich region
ScanRegExp	IPR001368	56	90	PS00652	TNFR/CD27/30/40/95 cysteine-rich region
ScanRegExp	IPR013032	134	149	PS01186	EGF-like region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp