ORK06183

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06183

Order Kazusa clone(s) from :

Accession No	AB209812
Product ID	ORK06183
Clone name	bm04283
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	NPTN
cDNA sequence	DNA sequence (2338 bp) Predicted protein sequence (391 aa)
Description	Neuroplastin precursor (Stromal cell-derived receptor 1) (SDR-1).

Features of the cloned cDNA sequence

Description

Length: 2338 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1161 bp
Genome contig ID	gi51511731r_71539416
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- GTGGATTCACCTGTTTTTAAAAATAAAACATTGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGGTGTTTGGATAATACTCTTTATTCTAATATCTTCTTTAATTTTAG

Features of the protein sequence

Description

Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93049	1.4e-141	100.0	stromal cell de...	Homo sapiens
AAD43217	6e-113	100.0	stromal cell-de...	Homo sapiens
XP_001928700	1.7e-108	91.2	neuroplastin [S...	Sus scrofa
CAA67712	2.9e-107	95.6	glycoprotein 56...	Rattus norvegicus
EDL95684	2.9e-107	95.6	stromal cell de...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	99	172	PF00047	Immunoglobulin
	IPR013151	219	274	PF00047	Immunoglobulin
	IPR013151	306	372	PF00047	Immunoglobulin
HMMSmart	IPR003599	91	199	SM00409	Immunoglobulin subtype
	IPR003598	97	177	SM00408	Immunoglobulin subtype 2
	IPR003599	212	289	SM00409	Immunoglobulin subtype
	IPR003599	298	388	SM00409	Immunoglobulin subtype
	IPR003598	304	377	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	79	188	PS50835	Immunoglobulin-like
	IPR007110	202	289	PS50835	Immunoglobulin-like
	IPR007110	292	380	PS50835	Immunoglobulin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp