Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07199
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209885
Product ID ORK07199
Clone name eg00407
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TRIM27
cDNA sequence DNA sequence (7005 bp)
Predicted protein sequence (382 aa)
Description Zinc finger protein RFP (Ret finger protein) (Tripartite motif- containing protein 27) (RING finger protein 76).
Features of the cloned cDNA sequence

Length: 7005 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5776 bp
Genome contig ID gi89161210r_28878759
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
CCCTCTGTTTAAAAATAAACTGAATATGGATGTTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACATTGTTGTTGCTTTCTGGGTGTTGGTAGGATTGGGTTCAGATGTTGGA

Features of the protein sequence

Length: 382 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93122 6.7e-147 100.0 ret finger prot...
 Homo sapiens
XP_001140726 2.8e-142 99.1 ret finger prot...
 Pan troglodytes
XP_001094465 3.1e-130 91.3 ret finger prot...
 Macaca mulatta
AAH69924 3.9e-118 86.2 Tripartite moti...
 Mus musculus
AAA36786 2.8e-117 99.6 tyrosine kinase...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000315 171 188 PR01406 Zinc finger
IPR000315 190 204 PR01406 Zinc finger
HMMPfam IPR001841 83 123 PF00097 Zinc finger
IPR000315 158 199 PF00643 Zinc finger
HMMSmart IPR001841 83 123 SM00184 Zinc finger
IPR000315 158 199 SM00336 Zinc finger
ProfileScan IPR001841 83 124 PS50089 Zinc finger
IPR000315 158 199 PS50119 Zinc finger
ScanRegExp IPR001841 98 107 PS00518 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp