Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05540
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209747
Product ID ORK05540
Clone name ek00360
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ITCH
cDNA sequence DNA sequence (2698 bp)
Predicted protein sequence (605 aa)
Description E3 ubiquitin-protein ligase Itchy homolog (EC 6.3.2.-) (Itch) (Atrophin-1-interacting protein 4) (AIP4) (NFE2-associated polypeptide 1) (NAPP1).
Features of the cloned cDNA sequence

Length: 2698 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 879 bp
Genome contig ID gi51511747f_32391712
PolyA signal sequence
(GATAAA,-7)		 
+----*----+----*----+----*----+----
TGTCTTTTTTTTGGGCAGCGTGGTGGGGGATAAAT
Flanking genome sequence
(168429 - 168478)		 
----+----*----+----*----+----*----+----*----+----*
AAATAAAAGGAAAAAAAACTTAGCCTAGAATTAGAATTAATTTAATTGAA

Features of the protein sequence

Length: 605 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92984 0 100.0 itchy homolog E...
 Homo sapiens
AAC04845 0 99.8 atrophin-1 inte...
 Homo sapiens
AAK39399 0 99.8 ubiquitin prote...
 Homo sapiens
EAW76277 0 99.8 itchy homolog E...
 Homo sapiens
Q96J02 0 99.8 E3 ubiquitin-pr...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001202 30 59 PF00397 WW/Rsp5/WWP
IPR001202 62 91 PF00397 WW/Rsp5/WWP
IPR001202 142 171 PF00397 WW/Rsp5/WWP
IPR001202 182 211 PF00397 WW/Rsp5/WWP
IPR000569 300 605 PF00632 HECT
HMMSmart IPR001202 29 61 SM00456 WW/Rsp5/WWP
IPR001202 62 93 SM00456 WW/Rsp5/WWP
IPR001202 141 173 SM00456 WW/Rsp5/WWP
IPR001202 181 213 SM00456 WW/Rsp5/WWP
IPR000569 269 605 SM00119 HECT
ProfileScan IPR001202 28 61 PS50020 WW/Rsp5/WWP
IPR001202 60 93 PS50020 WW/Rsp5/WWP
IPR001202 140 173 PS50020 WW/Rsp5/WWP
IPR001202 180 213 PS50020 WW/Rsp5/WWP
IPR000569 271 605 PS50237 HECT
ScanRegExp IPR001202 34 59 PS01159 WW/Rsp5/WWP
IPR001202 66 91 PS01159 WW/Rsp5/WWP
IPR001202 146 171 PS01159 WW/Rsp5/WWP
IPR001202 186 211 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp