ORK07093

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07093

Order Kazusa clone(s) from :

Accession No	AB209146
Product ID	ORK07093
Clone name	fg06748
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TFAP4
cDNA sequence	DNA sequence (6489 bp) Predicted protein sequence (293 aa)
Description	Transcription factor AP-4 (Activating enhancer-binding protein 4).

Features of the cloned cDNA sequence

Description

Length: 6489 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1373 bp
Genome contig ID	gi51511732r_4147189
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TAAAGAAACAAAATAAAGTTTGTACTTTGTTTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTCTGAGTCTCCTGGGTGTGGGCTGGCCTGAAGACCAGGGCAGGGCT

Features of the protein sequence

Description

Length: 293 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92383	2.4e-92	100.0	transcription f...	Homo sapiens
CAA40683	3.4e-56	97.5	transcription f...	Homo sapiens
Q01664	3.5e-56	97.5	Transcription f...	Homo sapiens
CAG46527	5.6e-56	97.0	TFAP4 [Homo sap...	Homo sapiens
EAW85322	6.4e-56	97.0	transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	103	154	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	108	159	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	100	154	PS50888	Basic helix-loop-helix dimerisation region bHLH

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp